Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts | BMC Microbiology | Full Text
Oomycete-specific ITS primers for identification and metabarcoding
A) Sensitivity of the first PCR (ITS1-ITS4 primer pair) with C.... | Download Scientific Diagram
Illustration of positions of universal primers (ITS1 and ITS4) and... | Download Scientific Diagram
Schematic representation of commonly used primers for amplifying parts... | Download Scientific Diagram
PCR amplification of DNA with primers ITS1, ITS4 (first primer pair)... | Download Scientific Diagram
Accurate Estimation of Fungal Diversity and Abundance through Improved Lineage-Specific Primers Optimized for Illumina Amplicon Sequencing | Applied and Environmental Microbiology
ITS as an environmental DNA barcode for fungi: an in silico approach reveals potential PCR biases | BMC Microbiology | Full Text
PCR-amplified products using ITS1 and ITS4 primers on Erysiphe (Sect.... | Download Scientific Diagram
PCR amplification using primer pair ITS1 and ITS4 showing amplification... | Download Scientific Diagram
Detection and Identification of Fungal Pathogens by PCR and by ITS2 and 5.8S Ribosomal DNA Typing in Ocular Infections | Journal of Clinical Microbiology
of primers used. ITS4 and ITS5 are standard primers for amplifying the... | Download Scientific Diagram
Sizes of ITS1-ITS4 PCR products for 6 Candida species, Aspergillus... | Download Table
Conserved primer sequences for PCR amplification of fungal rDNA | Vilgalys Mycology Lab - Duke University
Universal Sequence Primer TGAATCATCGACTCTTTGAACGC Forward (ITS1)... | Download Scientific Diagram
Fungal Identification Using Molecular Tools: A Primer for the Natural Products Research Community | Journal of Natural Products
The sequences of ITS1, ITS4, primers and AFLP adapters | Download Table
Structure of the rDNA gene in fungi indicating the two regions that... | Download Scientific Diagram
PCR products amplified with ITS1-ITS4 primers from six strains of... | Download Scientific Diagram
Sequence, target DNA, and annealing temperature for the polymerase... | Download Scientific Diagram
Selection and Experimental Evaluation of Universal Primers to Study the Fungal Microbiome of Higher Plants | Phytobiomes Journal
Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies | PLOS ONE
a. Amplified rDNA ITS region with ITS1 and ITS4 primers of wild (Lanes... | Download Scientific Diagram
Rapid Identification of Pathogenic Fungi Directly from Cultures by Using Multiplex PCR | Journal of Clinical Microbiology
choice of fungal primers - General Discussion - QIIME 2 Forum
Oligonucleotides
![Internal Transcribed spacer (ITS) region primers ITS1 and ITS 4 [8]... | Download Scientific Diagram](https://www.researchgate.net/publication/264669072/figure/fig1/AS:614269146112029@1523464585883/Internal-Transcribed-spacer-ITS-region-primers-ITS1-and-ITS-4-8-used-for.png "Internal Transcribed spacer (ITS) region primers ITS1 and ITS 4 [8]... | Download Scientific Diagram")